Early weight gain trajectories in first episode anorexia: predictors of outcome for emerging adults in outpatient treatment.

BACKGROUND: Early response to treatment has been shown to be a predictor of later clinical outcomes in eating disorders (EDs). Specifically, early weight gain trajectories in anorexia nervosa (AN) have been shown to predict higher rates of later remission in inpatient treatment. However, no study has, as of yet, examined this phenomenon within outpatient treatment of first episode cases of AN or in emerging adults. METHODS: One hundred seven patients with AN, all between the ages of 16 and 25 and with an illness duration of < 3 years, received treatment via the first episode rapid early intervention in eating disorders (FREED) service pathway. Weight was recorded routinely across early treatment sessions and recovery outcomes (BMI > 18.5 kg/m2 and eating psychopathology) were assessed up to 1 year later. Early weight gain across the first 12 treatment sessions was investigated using latent growth mixture modelling to determine distinct classes of change. Follow-up clinical outcomes and remission rates were compared between classes, and individual and clinical characteristics at baseline (treatment start) were tested as potential predictors. RESULTS: Four classes of early treatment trajectory were identified. Three of these classes (n = 95), though differing in their early change trajectories, showed substantial improvement in clinical outcomes at final follow-up. One smaller class (n = 12), characterised by a 'higher' start BMI (> 17) and no early weight gain, showed negligible improvement 1 year later. Of the three treatment responding groups, levels of purging, depression, and patient reported carer expressed emotion (in the form of high expectations and low tolerance of the patient) determined class membership, although these findings were not significant after correcting for multiple testing. A higher BMI at treatment start was not sufficient to predict optimal clinical outcomes. CONCLUSION: First episode cases of AN treated via FREED fit into four distinct early response trajectory classes. These may represent subtypes of first episode AN patients. Three of these four trajectories included patients with substantial improvements 1 year later. For those in the non-response trajectory class, treatment adjustments or augmentations could be considered earlier, i.e., at treatment session 12.

A key feature of anorexia nervosa (AN) is an unhealthily low body weight. Previous studies show that more weight gained early in inpatient treatment leads to better outcomes. This study tried to see if this was also true for outpatients receiving treatment for the first time. All participants were emerging adults between the ages of 16 and 25 who had been ill for less than 3 years. Weight was recorded across the first 12 weekly treatment sessions. Statistics showed that the patients fit roughly into four different groups in early treatment, each with different starting weights and rates of weight gain in the first 12 treatment sessions. The group a patient belonged to could sometimes be predicted by vomiting behaviours, level of depression, and patients' perception of parental tolerance and expectations at the start of treatment. Out of the four groups, three did relatively well 1 year later, but one small group of patients did not. This small group had a higher starting weight than many of the other groups but did not gain any weight across the first 12 sessions. These patients could benefit from a change or increase in the amount or intensity of treatment after the first 12 treatment sessions.

Neuroinflammation and Functional Connectivity in Alzheimer's Disease: Interactive Influences on Cognitive Performance.

Neuroinflammation is a key part of the etio-pathogenesis of Alzheimer's disease (AD). We tested the relationship between neuroinflammation and the disruption of functional connectivity in large-scale networks, and their joint influence on cognitive impairment. We combined [11C]PK11195 positron emission tomography (PET) and resting-state functional magnetic resonance imaging (rs-fMRI) in 28 patients (12 females/16 males) with clinical diagnosis of probable AD or mild cognitive impairment with positive PET biomarker for amyloid, and 14 age-, sex-, and education-matched healthy controls (8 females/6 males). Source-based "inflammetry" was used to extract principal components of [11C]PK11195 PET signal variance across all participants. rs-fMRI data were preprocessed via independent component analyses to classify neuronal and non-neuronal signals. Multiple linear regression models identified sources of signal covariance between neuroinflammation and brain connectivity profiles, in relation to the diagnostic group (patients, controls) and cognitive status.Patients showed significantly higher [11C]PK11195 binding relative to controls, in a distributed spatial pattern including the hippocampus, frontal, and inferior temporal cortex. Patients with enhanced loading on this [11C]PK11195 binding distribution displayed diffuse abnormal functional connectivity. The expression of a stronger association between such abnormal connectivity and higher levels of neuroinflammation correlated with worse cognitive deficits.Our study suggests that neuroinflammation relates to the pathophysiological changes in network function that underlie cognitive deficits in Alzheimer's disease. Neuroinflammation, and its association with functionally-relevant reorganization of brain networks, is proposed as a target for emerging immunotherapeutic strategies aimed at preventing or slowing the emergence of dementia.SIGNIFICANCE STATEMENT Neuroinflammation is an important aspect of Alzheimer's disease (AD), but it was not known whether the influence of neuroinflammation on brain network function in humans was important for cognitive deficit. Our study provides clear evidence that in vivo neuroinflammation in AD impairs large-scale network connectivity; and that the link between neuro inflammation and functional network connectivity is relevant to cognitive impairment. We suggest that future studies should address how neuroinflammation relates to network function as AD progresses, and whether the neuroinflammation in AD is reversible, as the basis of immunotherapeutic strategies to slow the progression of AD.

Statistical modelling of groundwater contamination monitoring data: A comparison of spatial and spatiotemporal methods.

Field monitoring of groundwater contamination plumes is an important component of managing risks for downgradient receptors and remedial strategies that rely on monitored natural attenuation. Collection of groundwater quality data can however take a considerable effort and be associated with high cost. Here, we investigated the relative merits of analyzing groundwater quality data using spatial compared to spatiotemporal statistical modelling and assessed the accuracy of both methods and implications for data collection requirements. The aim of this was to determine whether the quantity of data collected can be reduced, while retaining the same level of estimation accuracy, by analyzing groundwater contamination data using a spatiotemporal model which "borrows strength" across time, rather than a spatial model for individual sampling events. To capture the variability encountered under field conditions, we used three hypothetical groundwater contamination plumes with increasing complexity, and site data for a large groundwater gasoline additive plume. The results show that spatiotemporal methods can increase efficiency markedly so that, in comparison with repeated spatial analysis, spatiotemporal methods can achieve the same level of performance but with smaller sample sizes.

[18F]AV-1451 binding in vivo mirrors the expected distribution of TDP-43 pathology in the semantic variant of primary progressive aphasia.

INTRODUCTION: Semantic dementia, including the semantic variant of primary progressive aphasia (svPPA), is strongly associated with TAR-DNA binding protein 43 (TDP-43) type C pathology. It provides a useful model in which to test the specificity of in vivo binding of the putative tau ligand [18F]AV-1451, which is elevated in frontotemporal lobar degeneration tauopathies. METHODS AND RESULTS: Seven patients (five with svPPA and two with 'right' semantic dementia) and 12 healthy controls underwent positron emission tomography brain imaging with [18F]AV-1451. Two independent preprocessing methods were used. For both methods, all patients had clearly elevated binding potential (BPND (non-displaceable binding potential)) in temporal lobes, lateralising according to their clinical syndrome and evident in raw images. Region of interest analyses confirmed that BPND was significantly increased in temporal regions, insula and fusiform gyrus, consistent with those areas known to be most affected in semantic dementia. Hierarchical cluster analysis, based on the distribution of [18F]AV-1451 binding potential, separated semantic dementia from controls with 86% sensitivity and 100% specificity. CONCLUSIONS: [18F]AV-1451 binds in vivo regions that are likely to contain TDP-43 and not significant tau pathology. While this suggests a non-tau target for [18F]AV-1451, the pathological regions in semantic dementia do not normally contain significant levels of recently proposed 'off target' binding sites for [18F]AV-1451, such as neuronal monoamine oxidase or neuromelanin. Postmortem and longitudinal data will be useful to assess the utility of [18F]AV-1451 to differentiate and track different types of frontotemporal lobar degeneration.

Efficient and automatic methods for flexible regression on spatiotemporal data, with applications to groundwater monitoring.

Fitting statistical models to spatiotemporal data requires finding the right balance between imposing smoothness and following the data. In the context of P-splines, we propose a Bayesian framework for choosing the smoothing parameter, which allows the construction of fully automatic data-driven methods for fitting flexible models to spatiotemporal data. An implementation, which is highly computationally efficient and exploits the sparsity of the design and penalty matrices, is proposed. The findings are illustrated using a simulation study and two examples, all concerned with the modelling of contaminants in groundwater. This suggests that the proposed strategy is more stable that competing methods based on the use of criteria such as generalised cross-validation and Akaike's Information Criterion. © 2015 The Authors. Environmetrics Published by John Wiley Sons Ltd.

The effects of high levels of supplemental copper on the serum lipid profile, carcass traits, and carcass composition of goat kids.

This experiment was conducted to determine the effect of high levels of supplemental Cu (as (CuSO4).5H2O) on the serum lipid profile and carcass traits of goat kids. Fifteen Boer x Spanish wether goat kids (BW = 21.3 +/- 0.7 kg) were housed in individual pens and were assigned randomly to 1 of 3 treatments. Treatments consisted of 1) control (no additional supplemental Cu), 2) 100 mg of Cu/d, and 3) 200 mg of Cu/d. Copper sulfate was placed in gelatin capsules and inserted into the esophagus via a balling gun before the morning feeding. Animals were fed a high-concentrate (70:30 grain:hay) diet for 112 d. Serum lipid profile was determined on d 14 and 112, and BW was recorded after 4-h withdrawals from feed and water. After 112 d, animals were slaughtered, and carcass traits were measured. The left half of 12 carcasses and 9th to 11th rib sections from the right side of 15 carcasses were dissected into separable soft tissue and bone portions. The soft tissue portion was analyzed for moisture, ether extract, CP, and ash. Average daily feed intake decreased (linear; P = 0.05), and G:F increased (quadratic; P = 0.02) in the 100 mg of Cu/d group. Serum cholesterol and triglycerides did not change (P > 0.10); however, NEFA decreased (linear; P = 0.01) as supplemental Cu increased. No differences were observed (P > 0.10) in HCW, chilled carcass weight, or kidney and pelvic fat; however, 12th rib fat (linear; P = 0.01) and adjusted fat thickness (linear; P = 0.03) decreased as Cu supplementation increased. No differences (P > 0.10) in LM area were observed; however, percentage of boneless closely trimmed retail cuts increased (linear; P = 0.04) as Cu supplementation increased. The moisture (%) of the 9th to 11th rib sections increased (linear; P = 0.03), ether extract (%) decreased (linear; P = 0.02), and CP and ash (%) tended to increase (linear; P = 0.09 and 0.06, respectively) as Cu supplementation increased. Carcass composition measured using the left half of the carcass confirmed the values obtained through the 9th to 11th rib sections. Results of this study indicate that supplemental Cu can alter the serum lipid profile, carcass characteristics, and carcass composition of goat kids.

Improving pork quality by feeding supranutritional concentrations of vitamin D3.

Duroc-cross pigs (n = 25) were assigned to one of three experimental finishing diets containing 0 (control), 40,000 (40), or 80,000 (80) IU of supplemental vitamin D3/kg of feed (as-fed basis)to test the effects of vitamin D3 on pork quality traits. Experimental diets were fed for 44 or 51 d before slaughter, and days on feed were blocked in the experimental design. A trend existed for pigs receiving the highest concentration of vitamin D3 supplementation to have a lower (P = 0.08) ADG (0.77 kg/d) compared with pigs fed either the 40-diet (0.88 kg/d) or control (0.92 kg/d). Diet did not (P > 0.10) affect backfat thickness measured along the midline, 10th-rib fat depth, longissimus muscle area, muscle score, or hot carcass weights. Longissimus pH, measured at 0.5, 1, 2, 3, 4, and 24 h postmortem, was higher (P < 0.05) for pigs on the 80-diet than those fed the control diet. Longissimus muscle color, measured at 24 h postmortem, from pigs fed either the 40- or 80-diet were darker (lower L* values; P < 0.05) than those fed the control diet. Objective longissimus color scores were higher (P < 0.01), and firmness/wetness scores lower (P < 0.05), for pigs on the 80-diet as compared to those on the 40-diet or control diet. The diet had no (P > 0.10) effect on Warner-Bratzler shear force values; percentage of cook loss; or trained sensory panel evaluations for tenderness, juiciness, and flavor. Feeding the 80-diet increased (P < 0.05) plasma vitamin D3 and calcium after 2, 4, and 6 wk on feed compared with the control diet. Vitamin D3 and 25-hydroxy vitamin D3 concentrations in the longissimus muscle increased (P = 0.001) with increasing vitamin D3 levels in the diet; however, muscle calcium concentrations and fiber type were not (P > 0.30) affected by diet. These results indicate that feeding supranutritional levels of vitamin D3 for at least 44 d improves pork color and increases pH, but may retard growth if fed at 80,000 IU/kg of feed.

Cyclin-dependent kinase 5 is expressed in both Sertoli cells and metaphase spermatocytes.

OBJECTIVE: To gain insight into the function of cyclin-dependent kinase 5 (Cdk5) in spermatogenesis. DESIGN: The expression of the Cdk5 protein was determined with the use of immunohistochemical and immunoblot analysis. SETTING: Academic research laboratory. ANIMAL(S): Adult mouse and archival human testicular tissue were used for the immunohistochemical analysis. Adult mice were used as the source of tissues for the immunoblot analysis. INTERVENTION(S): The immunohistochemical analysis was performed with an anti-Cdk5 antibody. The double immunohistochemical analysis was performed with anti-Cdk5 and alpha-tubulin antibodies. Immunoblotting was used to examine multiple mouse tissues for Cdk5 expression. MAIN OUTCOME MEASURE(S): Analysis of Cdk5 protein distribution. RESULT(S): Cdk5 was localized specifically within the cytoplasm of Sertoli cells and meiotic metaphase germ cells. The double immunohistochemistry analysis demonstrated the co-localization of Cdk5 and alpha-tubulin within the Sertoli cells. Western blot analysis revealed a high level of expression of Cdk5 in the testicular lysate. CONCLUSION(S): The cyclin-dependent kinases are known regulators of the cell cycle; however, Cdk5 expression previously has been described in terminally differentiated cells of the brain. The present evidence of an association between Cdk5 and microfilaments of Sertoli cells and meiotic metaphase germ cells suggests a role of Cdk5 in both seminiferous tubule function and meiosis.

Antioxidant status affects color stability and tenderness of calcium chloride-injected beef.

The objectives of this study were to determine whether vitamin E supplementation influences color and tenderness of beef injected with calcium chloride. Market heifers (n = 12) were fed a standard finishing diet with minimal levels of vitamin E (NE group). Another 12 market heifers were fed the NE diet with the inclusion of 1,000 IU/d of DL-alpha-tocopherol per animal for the last 125 d on feed (E group). Animals were slaughtered after 125 d on the diets and upon reaching an ultrasound backfat thickness > 10 mm. Half of the longissimus muscles from each treatment group (NE and E) were pumped to 10% over the original weight with 250 mM CaCl2 (Ca) at 24 h postmortem. Remaining muscles (NE and E) were pumped to 10% over the original weight with water (NC) at 24 h postmortem. After equilibrating overnight, steaks (2.54 cm) were overwrapped with O2-permeable film and stored for 7 d after injection. Hunter "L," "a," and "b" values were obtained each day of storage. Trained panelists evaluated color on d 1, 4, and 7 after injection. 2-Thiobarbituric acid-reactive substances (TBARS) values were measured on d 1 and 7 after injection. Warner-Bratzler (W-B) shear force values and trained sensory panel evaluations at 1, 3, and 7 d after injection were obtained. Immunoblotting techniques were used to monitor the 30-kDa degradation product of troponin-T at 1, 3, and 7 d after injection. At 4 d after injection, E/Ca steaks were the least discolored (P < 0.05). The E/Ca steak TBARS values were not significantly different from values for NE/NC steaks at 7 d after injection, whereas NE/Ca steaks had greater (P < 0.05) TBARS values after 7 d following injection compared with all other groups. Treatment with Ca resulted in higher off-flavor scores (P < 0.05). The E/Ca samples had the most rapid tenderization and proteolysis of all treatment groups. Warner-Bratzler shear values were lower in the E/Ca samples than in the E/NC samples at 1, 3, and 7 d after injection (P < 0.05). No difference in shear force was noted between NE/Ca and NE/NC samples at any time point. No difference in sensory tenderness was noted between NE/Ca and NE/NC samples at 1 d after injection. However, Ca-injected samples (NE/Ca and E/Ca) were rated as being significantly more tender than their uninjected counterparts (NE/NC and E/NC) at 3 and 7 d after injection. Injection of CaCl2 may result in more rapid and immediate tenderization if beef from animals supplemented with vitamin E is used. Vitamin E incorporation into muscle tissue may potentiate the action of exogenously added calcium by protecting the calpains from oxidation.

DNA abasic lesions in a different light: solution structure of an endogenous topoisomerase II poison.

Topoisomerase II is the target for several anticancer drugs that "poison" the enzyme and convert it to a cellular toxin by increasing topoisomerase II-mediated DNA cleavage. In addition to these "exogenous topoisomerase II poisons," DNA lesions such as abasic sites act as "endogenous poisons" of the enzyme. Drugs and lesions are believed to stimulate DNA scission by altering the structure of the double helix within the cleavage site of the enzyme. However, the structural alterations that enhance cleavage are unknown. Since abasic sites are an intrinsic part of the genetic material, they represent an attractive model to assess DNA distortions that lead to altered topoisomerase II function. Therefore, the structure of a double-stranded dodecamer containing a tetrahydrofuran apurinic lesion at the +2 position of a topoisomerase II DNA cleavage site was determined by NMR spectroscopy. Three major features distinguished the apurinic structure ( = 0.095) from that of wild-type ( = 0.077). First, loss of base stacking at the lesion collapsed the major groove and reduced the distance between the two scissile phosphodiester bonds. Second, the apurinic lesion induced a bend that was centered about the topoisomerase II cleavage site. Third, the base immediately opposite the lesion was extrahelical and relocated to the minor groove. All of these structural alterations have the potential to influence interactions between topoisomerase II and its DNA substrate.

Site-specific synthesis of aflatoxin B(1) adducts within an oligodeoxyribonucleotide containing the human p53 codon 249 sequence.

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

The deformation behavior and mechanical properties of chondrocytes in articular cartilage.

INTRODUCTION: Chondrocytes in articular cartilage utilize mechanical signals to regulate their metabolic activity. A fundamental step in determining the role of various biophysical factors in this process is to characterize the local mechanical environment of the chondrocyte under physiological loading. METHODS: A combined experimental and theoretical approach was used to quantify the in-situ mechanical environment of the chondrocyte. The mechanical properties of enzymatically-isolated chondrocytes and their pericellular matrix (PCM) were determined using micropipette aspiration. The values were used in a finite element model of the chondron (the chondrocyte and its PCM) within articular cartilage to predict the stress-strain and fluid flow microenvironment of the cell. The theoretical predictions were validated using three-dimensional confocal microscopy of chondrocyte deformation in situ. RESULTS: Chondrocytes were found to behave as a viscoelastic solid material with a Young's modulus of approximately 0.6 kPa. The elastic modulus of the PCM was significantly higher than that of the chondrocyte, but several orders of magnitude lower than that of the extracellular matrix. Theoretical modeling of cell-matrix interactions suggests the mechanical environment of the chondrocyte is highly non-uniform and is dependent on the viscoelastic properties of the PCM. Excellent agreement was observed between the theoretical predictions and the direct measurements of chondrocyte deformation, but only if the model incorporated the PCM. CONCLUSIONS: These findings imply that the PCM plays a functional biomechanical role in articular cartilage, and alterations in PCM properties with aging or disease will significantly affect the biophysical environment of the chondrocyte.

Alterations in the Young's modulus and volumetric properties of chondrocytes isolated from normal and osteoarthritic human cartilage.

The mechanical environment of the chondrocyte is an important factor that influences the maintenance of the articular cartilage extracellular matrix. Previous studies have utilized theoretical models of chondrocytes within articular cartilage to predict the stress-strain and fluid flow environments around the cell, but little is currently known regarding the cellular properties which are required for implementation of these models. The objectives of this study were to characterize the mechanical behavior of primary human chondrocytes and to determine the Young's modulus of chondrocytes from non-osteoarthritic ('normal') and osteoarthritic cartilage. A second goal was to quantify changes in the volume of isolated chondrocytes in response to mechanical deformation. The micropipette aspiration technique was used to measure the deformation of a single chondrocyte into a glass micropipette in response to a prescribed pressure. The results of this study indicate that the human chondrocyte behaves as a viscoelastic solid. No differences were found between the Young's moduli of normal (0.65+/-0.63 kPa, n = 44) and osteoarthritic chondrocytes (0.67+/-0.86 kPa, n = 69, p = 0.93). A significant difference in cell volume was observed immediately and 600 s after complete aspiration of the cell into the pipette (p < 0.001), and the magnitude of this volume change between normal (11+/-11%, n = 40) and osteoarthritic (20+/-11%, n = 41) chondroctyes was significantly different at both time points (p < 0.002). This finding suggests that chondrocytes from osteoarthritic cartilage may have altered volume regulation capabilities in response to mechanical deformation. The mechanical and volumetric properties determined in this study will be of use in analytical and finite element models of chondrocyte-matrix interactions in order to better predict the mechanical environment of the cell in vivo.

Quantitative analysis of chemical warfare agent degradation products in reaction masses using capillary electrophoresis.

Quantitative methods have been developed for the analysis of chemical warfare agent degradation products in reaction masses using capillary electrophoresis (CE). This is the first report of a systematic validation of a CE-based method for the analysis of chemical warfare agent degradation products in agent neutralization matrixes (reaction masses). After neutralization with monoethanolamine/water, the nerve agent GB (isopropyl methylphosphonofluoridate, Sarin) gives isopropyl methylphosphonic acid (IMPA) and O-isopropyl O'-(2-amino)ethyl methylphosphonate (GB-MEA adduct). The nerve agent GD (pinacolyl methylphosphonofluoridate, Soman), [pinacolyl = 2-(3,3-dimethyl)butyl] produces pinacolyl methylphosphonic acid (PMPA) and O-pinacolyl O'-(2-amino)ethyl methylphosphonate (GD-MEA adduct). The samples were prepared by dilution of the reaction masses with deionized water before analysis by CE/indirect UV detection or CE/conductivity detection. Migration time precision was less than 4.0% RSD for IMPA and 5.0 RSD for PMPA on a day-to-day basis. The detection limit for both IMPA and PMPA is 100 micrograms/L; the quantitation limit for both is 500 micrograms/L. For calibration standards, IMPA and PMPA gave a linear response (R2 = 0.9999) over the range 0.5-100 micrograms/mL. The interday precision RSDs were 1.9, 1.0, and 0.7% for IMPA at 7.5, 37.5 and 75.0 micrograms/mL, respectively. Corresponding values for PMPA (again, RSD) were 2.9, 1.1, and 1.0% at 7.5, 37.5 and 87.5 micrograms/mL, respectively, as before. Analysis accuracy was assessed by spiking actual neutralization samples with IMPA or PMPA. For IMPA, the seven spike levels used ranged from 20 to 220% of the IMPA background level, and the incremental change in the found IMPA level ranged from 86 to 99 % of the true spiking increment (R2 = 0.9987 for the linear regression). For PMPA, the five spike levels ranged from 10 to 150% of the matrix background level, and similarly, the accuracy obtained ranged from 95 to 97% of the true incremental value (R2 = 0.9999 for the linear regression).

Refined structure of the doubly intercalated d(TATAFBGCATA)2 aflatoxin B1 adduct.

The refined solution structure for the 8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B1 adduct was refined from the oligodeoxynucleotide duplex d(TATAFBGCATA)2 using a molecular dynamics protocol restrained by NOE data obtained from 1H NMR and compared with the refined structure of the unmodified oligomer, d(TATGCATA)2. The two aflatoxin B1 (AFB1) moieties were symmetry related by the pseudodyad axis of the self-complementary oligodeoxynucleotide. Each AFB1 intercalated into the helix above the 5'-face of the modified guanine, corroborating NMR spectroscopic data [Gopalakrishnan, S., Harris, T. M., and Stone, M. P. (1990) Intercalation of Aflatoxin B1 in Two Oligodeoxynucleotide Adducts: Comparative 1H NMR Analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2 Biochemistry 29, 10438-10448]. Molecular dynamics calculations restrained with 292 experimentally and empirically derived distances refined a family of structures characterized by pairwise root mean square differences of <1.3 A. Complete relaxation matrix calculations yielded a sixth root residual of 11 x 10(-2). Comparison of the refined structure with that of the corresponding unmodified oligodeoxynucleotide suggested that the two AFB1 adducts introduced a perturbation of the DNA localized at the two sites of adduction. The calculations predicted that each adduct introduced a "kink" into the DNA helical axis. However, the pseudodyad symmetry relating the two intercalation sites resulted in no net bending of the DNA. The results suggest the possibility that AFB1 lesions at adjacent guanines in the 5'-GC-3' sequence may be recognized or processed differently than are isolated AFB1 lesions.

Reactivity of human trophoblast monoclonal antibodies with marmoset monkey trophoblast cultures.

The aim of this study was to determine whether cultured trophoblast tissues, derived from the trophectoderm of marmoset monkey blastocysts, contain homologues of human trophoblast antigens. This is an essential prerequisite to determine whether the marmoset may be a suitable model for preclinical testing of a human antitrophoblast antigen for fertility regulation. Previously evaluated monoclonal antibodies from the Flinders University laboratory, which reacted with human trophoblast with a high degree of specificity, were tested for immunohistochemical reactivity using an immunoperoxidase detection method on both frozen and paraformaldehyde-fixed sections of the cultured marmoset monkey trophoblast. All monoclonal antibodies raised against human placenta reacted positively, when compared to controls, suggesting that human and marmoset trophoblast cells share common epitopes. The specificity of the monoclonal antibodies was investigated by determining whether there was cross-reactivity with other marmoset monkey tissues, including adrenal, spleen, kidney, liver, muscle, ovary and testis. The specificities of the monoclonal antibodies on these marmoset tissues were similar to those previously found on the corresponding human tissues. We have concluded that marmoset monkey trophoblast exhibits homologues of human trophoblast antigens. The findings also suggest that marmoset monkeys should be evaluated further as a primate model to test suitable target antigens for antitrophoblast vaccines that may be useful contragestation agents in humans.

Separation of chemical warfare agent degradation products by the reversal of electroosmotic flow in capillary electrophoresis.

We report the development of analyses for nerve agent degradation products or related species by the reversal of electroosmotic flow in capillary electrophoresis (CE). The developed methods were used in this laboratory for analysis of samples in the second and third official proficiency tests (International Round-Robins) for the Provisional Technical Secretariat/Preparatory Commission for the Organization for the Prohibition of Chemical Weapons, and those results are reported here. Analytes studied include methylphosphonic acid (a dibasic acid), the monoisopropyl ester of ethylphosphonic acid, and the monoalkyl esters of methylphosphonic acid (R = ethyl, isopropyl, isobutyl, pinacolyl (3,3-dimethyl-2-butyl), cyclohexyl, and 2-ethylhexyl). The cationic surfactants used here for the reversal of electroosmotic flow are didodecyldimethylammonium hydroxide and cetyltrimethylammonium hydroxide. CE methods using conductivity or indirect UV detection provide a good separation efficiency and very high sensitivity for the analysis of such compounds. The detection limits for these species were about 75 micrograms/L when using conductivity detection and about 100 micrograms/L when using indirect UV detection. Because pH plays an important role in the CE separation of the alkylphosphonic acids and their monoesters, the influence of pH on these separation systems was investigated. Electrolytes were stable for at least 3 months. Excellent separation efficiency and freedom from interference due to common anions were obtained in the developed methods which typically achieved complete separations in less than 3 min. The method was applied to aqueous leachates of soil, wipes of surfaces, and vegetation sampled from a field site known to have been exposed to nerve agents and subsequently cleaned up. The data from these environmental samples indicated that the method can be expected to be useful for environmental monitoring.

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Quantitative Analysis of Anions at ppb/ppt Levels with Capillary Electrophoresis and Conductivity Detection: Enhancement of System Linearity and Precision Using an Internal Standard.

Capillary electrophoresis with conductivity detection is evaluated for quantitative analysis of anions at low- to sub-ppb concentration levels in the presence and absence of a conductive sample matrix composed of 2 ppm ammonia and 50 ppb hydrazine. The low-level sensitivity is extended by a transient isotachophoretic stacking procedure. The linear range of the CE system and conductivity detector is graphically evaluated on the basis of absolute and corrected (normalized) chloride and sulfate peak profiles using an ASTM linearity criterion. The influence of random contamination bias from ubiquitous entities of nonsample chloride and sulfate levels introduced by liquid handling, laboratory atmosphere, and bulk chemical residues is quantitatively compared against an internal (contamination) reference ion.

Immunocontraceptives.

The advent of immunocontraceptives represents the first truly novel approach to the development of family planning methods in over 30 years. Such products would have many advantages over existing contraceptives in that they would not elicit metabolic disturbances, would provide long-acting (i.e. 6 to 12 months) protection from pregnancy, be easy to administer, be economical to manufacture and distribute, and could, depending on their composition, be used by either men or women. Several lines of research and development currently in progress are aimed at the development of safe and effective immunocontraceptives based on reproductive hormones, components of the gametes (sperm and ova) and products of the early pre-implantation conceptus. The only prototype immunocontraceptives to have reached the stage of clinical trials in women are those based on the hormone human chorionic gonadotropin, and in men that based on follicle-stimulating hormone. However, extensive research is also underway on immunocontraceptives based on sperm and ovum components for use by women, and on immunocontraceptives based on sperm components and gonadotropin-releasing hormone for use by men. Before such preparations can be made available for wide-scale use, further research is needed on ways to overcome genetically determined variations in individual immune responses so that protective responses of a predetermined duration can be elicited in all recipients. It is anticipated that these technical problems can be solved and the clinical testing of lead products will be completed in the next decade. Almost all of the financial support for the research and development of immunocontraceptives has been provided by academic institutions and public sector agencies. In general, the pharmaceutical industry has not been willing to engage in new contraceptive development, largely because of concerns about product liability claims, anticipated low profitability and/or the risk of negative publicity. Therefore, the further development, manufacture and distribution of immunocontraceptives will probably require the collaboration of public sector agencies, governments and industry in order to overcome the current paucity of effort being put into the development and provision of new, safe, effective and acceptable methods of family planning. The purpose of this review is to provide information on the current status of research and development of potential immunocontraceptives and to attempt to stimulate pharmaceutical companies to reassess their positions with regard to the development, manufacture and distribution of these products.